CircNet

General Information

circRNA Basic Information

CircID	chr10:122297768\|122299134
Strand	+
CircType	exon
Host Gene	ENSG00000138152.8;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTGCGTGGATGTGATGATAGCCAGACTCAAGCCAAGCACCATCAAGAAATTCTACGAGGCCGGCTGCAAGTACAAGGAAGAGCAGCTCACCACCGGCTGCGAGAAGTGGCTGGAAATGAACTTGGTTCCTCTAGGGGGGACGCAGATCCACCTCCACAAAATCCCACAGGACCTGCTCCACAAAGTGCTGAAGTCCCCCAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites
chr10:122297768\|122299134	DGCR8	2	0
chr10:122297768\|122299134	RBM5	1	0
chr10:122297768\|122299134	XPO5	0	1
chr10:122297768\|122299134	ELAVL1	0	2
chr10:122297768\|122299134	NCBP2	1	0
chr10:122297768\|122299134	CSTF2T	0	1
chr10:122297768\|122299134	CSTF2	1	2
chr10:122297768\|122299134	SFPQ	3	2
chr10:122297768\|122299134	HNRNPK	0	1
chr10:122297768\|122299134	HNRNPM	2	0
chr10:122297768\|122299134	TAF15	0	1
chr10:122297768\|122299134	PTBP1	2	9
chr10:122297768\|122299134	HNRNPC	1	1
chr10:122297768\|122299134	NUDT21	0	1
chr10:122297768\|122299134	AGO2	0	1

CircRNA Information