CircNet

General Information

circRNA Basic Information

CircID	chr10:67888882\|67906937
Strand	+
CircType	exon
Host Gene	ENSG00000096717.11;
Algorism	find_circ;CIRI2;DCC;
Sequence	GAAATATATCCTGGACAATTCCAGCCATCTCTCTGTCACAAATTCATAGCCTTGTCAGATAAGGAAGGAAAACTACTTCGCAACTATACCCAGAACATAGACACGCTGGAACAGGTTGCGGGAATCCAAAGGATAATTCAGTGTCATG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr10:67888882\|67906937	KHSRP	1	0	0
chr10:67888882\|67906937	ELAVL1	5	0	0
chr10:67888882\|67906937	NUMA1	1	0	0
chr10:67888882\|67906937	SF3B4	1	0	0
chr10:67888882\|67906937	CELF2	1	0	0
chr10:67888882\|67906937	PRPF8	0	3	1
chr10:67888882\|67906937	UPF1	1	0	0
chr10:67888882\|67906937	TAF15	1	2	0
chr10:67888882\|67906937	FMR1	0	0	3
chr10:67888882\|67906937	CPSF6	1	0	0
chr10:67888882\|67906937	U2AF2	23	4	2
chr10:67888882\|67906937	FUS	1	0	0
chr10:67888882\|67906937	SRSF7	1	0	0
chr10:67888882\|67906937	SRSF1	0	0	1
chr10:67888882\|67906937	NOP58	0	0	2
chr10:67888882\|67906937	U2AF1	7	0	0
chr10:67888882\|67906937	NOP56	1	0	1
chr10:67888882\|67906937	DDX54	0	0	3
chr10:67888882\|67906937	TROVE2	1	0	0
chr10:67888882\|67906937	PTBP1	3	0	0
chr10:67888882\|67906937	HNRNPC	2	0	0
chr10:67888882\|67906937	HNRNPM	2	0	0
chr10:67888882\|67906937	HNRNPA1	1	1	0
chr10:67888882\|67906937	IGF2BP1	0	0	3
chr10:67888882\|67906937	IGF2BP3	0	0	1
chr10:67888882\|67906937	IGF2BP2	0	1	2
chr10:67888882\|67906937	TARDBP	1	0	0
chr10:67888882\|67906937	BUD13	1	0	1
chr10:67888882\|67906937	RBFOX2	0	1	0
chr10:67888882\|67906937	RBM47	0	0	1
chr10:67888882\|67906937	SLTM	0	1	0
chr10:67888882\|67906937	HNRNPA2B1	1	0	0
chr10:67888882\|67906937	DDX42	1	0	0
chr10:67888882\|67906937	TIA1	1	0	0
chr10:67888882\|67906937	RBM22	0	1	0
chr10:67888882\|67906937	AGO2	2	0	0
chr10:67888882\|67906937	AGO1	0	1	0
chr10:67888882\|67906937	EIF4A3	3	1	2
chr10:67888882\|67906937	FBL	0	0	2

CircRNA Information