CircRNA Information

General Information
circRNA Basic Information
CircID chr10:70729294|70730258
Strand +
CircType exon
Host Gene ENSG00000138316.10;
Algorism find_circ;CIRI2;DCC;
Sequence GTAGATGAGATTTACCACGATGAGTCCCTGGGGGTTCATATAAATATTGCCCTCGTCCGCTTGATCATGGTTGGCTACCGACAGTCCCTGAGCCTGATCGAGCGCGGGAACCCCTCACGCAGCCTGGAGCAGGTGTGTCGCTGGGCACACTCCCAGCAGCGCCAGGACCCCAGCCACGCTGAGCACCATGACCACGTTGTGTTCCTCACCCGGCAGGACTTTGGGCCCTCAGGTATGCAAG
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
chr10:70729294|70730258 hsa-miR-211-3p 0 1 1
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

    by mir_boxplot.py


circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr10:70729294|70730258 U2AF2 1 0 0
chr10:70729294|70730258 ELAVL1 1 0 0
chr10:70729294|70730258 TNRC6A 0 2 0
chr10:70729294|70730258 HNRNPA1 1 0 0
chr10:70729294|70730258 CSTF2 0 2 0
chr10:70729294|70730258 FUS 0 1 0
chr10:70729294|70730258 TAF15 1 1 0
chr10:70729294|70730258 DKC1 0 1 0
chr10:70729294|70730258 PTBP1 1 2 0
chr10:70729294|70730258 TARDBP 1 0 0