CircNet

General Information

circRNA Basic Information

CircID	chr10:92919982\|92952382
Strand	+
CircType	exon
Host Gene	ENSG00000138190.16;
Algorism	CIRI2;
Sequence	ATCTTAACTGTTCAGGATCTTGTTGATTTTTCCCCTGTTTATCGATGTTTGCACATTTATTCTGTTTTGCATGAAACAGTTGATGGCTATAGAAGATATTTCACTCAAATTGTAGG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr10:92919982\|92952382	U2AF2	3	2	0
chr10:92919982\|92952382	MOV10	3	0	0
chr10:92919982\|92952382	ELAVL1	7	6	0
chr10:92919982\|92952382	RBM47	0	1	0
chr10:92919982\|92952382	HNRNPC	7	1	0
chr10:92919982\|92952382	NOP58	3	0	0
chr10:92919982\|92952382	NOP56	1	0	0
chr10:92919982\|92952382	IGF2BP1	0	1	0
chr10:92919982\|92952382	RBM10	1	0	0
chr10:92919982\|92952382	IGF2BP2	0	1	0
chr10:92919982\|92952382	DKC1	1	0	0
chr10:92919982\|92952382	FMR1	1	0	0
chr10:92919982\|92952382	FIP1L1	1	0	0
chr10:92919982\|92952382	PTBP1	1	0	0
chr10:92919982\|92952382	FBL	1	0	0
chr10:92919982\|92952382	EWSR1	1	0	0
chr10:92919982\|92952382	EIF4A3	0	0	2
chr10:92919982\|92952382	FUS	1	0	0

CircRNA Information