CircNet

General Information

circRNA Basic Information

CircID	chr11:15986204\|16111923
Strand	-
CircType	exon
Host Gene	ENSG00000110693.16;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTTCAGGGTCACATGCCTCCGCTCATGATCCCAATTTTTCCACATGACCAGCGGACTCTGGCAGCAGCTGCTGCTGCCCAACAGGGATTCCTCTTCCCCCCTGGAATAACATACAAACCAGAAGGGTCATGTCTCCCACCCACAAATTAACCAAAGGCTAAAGGGCCTAAGTGACCGTTTTGGCAGGAATTTGGACACCTTTGAACATGGTGGTGGCCACTCTTACAACCACAAACAGATTGAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr11:15986204\|16111923	HNRNPC	1	0	0
chr11:15986204\|16111923	SRSF1	0	1	0
chr11:15986204\|16111923	ELAVL1	0	1	0
chr11:15986204\|16111923	U2AF2	1	0	0
chr11:15986204\|16111923	PRPF8	0	0	1
chr11:15986204\|16111923	TAF15	1	1	0
chr11:15986204\|16111923	PTBP1	0	2	0
chr11:15986204\|16111923	IGF2BP2	0	0	3

CircRNA Information