CircNet

General Information

circRNA Basic Information

CircID	chr11:69054033\|69062990
Strand	+
CircType	exon
Host Gene	ENSG00000162341.16;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTGCCGCGGCCAGGTGGGACCTCTGCATTGATCAGGCTGTGGTCTTCATCGAAGATGCTATTCAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr11:69054033\|69062990	FUS	2	2	0
chr11:69054033\|69062990	CELF2	0	2	0
chr11:69054033\|69062990	PRPF8	0	4	0
chr11:69054033\|69062990	TAF15	1	0	0
chr11:69054033\|69062990	CSTF2	0	4	0
chr11:69054033\|69062990	GNL3	0	1	0
chr11:69054033\|69062990	DGCR8	1	1	0
chr11:69054033\|69062990	SRSF1	0	1	0
chr11:69054033\|69062990	NOP58	1	1	0
chr11:69054033\|69062990	NOP56	1	1	0
chr11:69054033\|69062990	DDX54	0	1	0
chr11:69054033\|69062990	LSM11	1	0	0
chr11:69054033\|69062990	RBM10	1	0	0
chr11:69054033\|69062990	TRA2A	0	1	0
chr11:69054033\|69062990	RBFOX2	0	1	0
chr11:69054033\|69062990	DDX42	1	0	0
chr11:69054033\|69062990	TIA1	0	1	0
chr11:69054033\|69062990	RBM22	0	1	0
chr11:69054033\|69062990	DKC1	1	0	0
chr11:69054033\|69062990	HNRNPK	0	1	0
chr11:69054033\|69062990	AGO2	2	1	0
chr11:69054033\|69062990	EIF4A3	3	4	2
chr11:69054033\|69062990	FBL	2	1	0

CircRNA Information