CircRNA Information

General Information
circRNA Basic Information
CircID chr11:9169856|9207632
Strand -
CircType exon
Host Gene ENSG00000184014.7;
Algorism find_circ;CIRI2;DCC;
Sequence CATTATGCCAGTACATACAGGCTTCTAAAGCCAGGGATGGTGCCAGCCCTTTCATTTCAAGTACGACTGAAG
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr11:9169856|9207632 SLBP 0 1 0
chr11:9169856|9207632 ELAVL1 9 1 0
chr11:9169856|9207632 SF3B1 1 0 0
chr11:9169856|9207632 UPF1 0 1 0
chr11:9169856|9207632 TAF15 0 1 0
chr11:9169856|9207632 FMR1 0 3 1
chr11:9169856|9207632 NOP58 0 1 0
chr11:9169856|9207632 U2AF2 8 12 0
chr11:9169856|9207632 NOP56 1 0 1
chr11:9169856|9207632 RBM10 2 3 0
chr11:9169856|9207632 SF3A3 1 0 0
chr11:9169856|9207632 PTBP1 3 3 0
chr11:9169856|9207632 HNRNPC 13 2 0
chr11:9169856|9207632 ZNF184 0 1 0
chr11:9169856|9207632 RBFOX2 0 1 0
chr11:9169856|9207632 LIN28B 1 0 0
chr11:9169856|9207632 FXR1 0 1 0
chr11:9169856|9207632 FXR2 0 0 1
chr11:9169856|9207632 IGF2BP1 0 2 1
chr11:9169856|9207632 IGF2BP2 0 0 1
chr11:9169856|9207632 TARDBP 3 5 0
chr11:9169856|9207632 BUD13 0 1 0
chr11:9169856|9207632 KHSRP 3 0 0
chr11:9169856|9207632 CSTF2 0 1 0
chr11:9169856|9207632 RBM22 0 2 0
chr11:9169856|9207632 EIF4A3 3 2 2
chr11:9169856|9207632 FBL 0 0 1