CircNet

General Information

circRNA Basic Information

CircID	chr11:95191404\|95193522
Strand	-
CircType	exon
Host Gene	ENSG00000149212.11;
Algorism	find_circ;CIRI2;DCC;
Sequence	GATAAAAGAATCAGAGTGTCTCAACCCTTGACAAGAGGACCAAGTGCCTTTATTCCAGAGAAGGAA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr11:95191404\|95193522	DGCR8	1	0	0
chr11:95191404\|95193522	QKI	1	0	0
chr11:95191404\|95193522	NOP56	3	0	0
chr11:95191404\|95193522	ELAVL1	2	1	0
chr11:95191404\|95193522	KHSRP	1	0	0
chr11:95191404\|95193522	IGF2BP2	1	0	0
chr11:95191404\|95193522	U2AF2	9	4	2
chr11:95191404\|95193522	LIN28B	1	0	0
chr11:95191404\|95193522	FUS	0	1	0
chr11:95191404\|95193522	FBL	1	0	0
chr11:95191404\|95193522	UPF1	0	1	0
chr11:95191404\|95193522	TAF15	0	1	0
chr11:95191404\|95193522	FMR1	0	0	3
chr11:95191404\|95193522	PTBP1	0	0	1
chr11:95191404\|95193522	AGO2	0	0	1
chr11:95191404\|95193522	EWSR1	0	1	0
chr11:95191404\|95193522	EIF4A3	0	2	0
chr11:95191404\|95193522	NOP58	2	1	1

CircRNA Information