CircNet

General Information

circRNA Basic Information

CircID	chr12:118239227\|118244965
Strand	-
CircType	exon
Host Gene	ENSG00000135090.13;
Algorism	CIRI2;
Sequence	TTGGTGATGGAATATTGCTTAGGCTCAGCCTCTGATTTATTAGAAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr12:118239227\|118244965	U2AF2	5	2	0
chr12:118239227\|118244965	BUD13	0	1	1
chr12:118239227\|118244965	FUS	0	2	0
chr12:118239227\|118244965	U2AF1	1	0	0
chr12:118239227\|118244965	IGF2BP2	2	0	0
chr12:118239227\|118244965	NOP56	1	0	0
chr12:118239227\|118244965	CELF2	0	2	0
chr12:118239227\|118244965	HNRNPC	1	0	0
chr12:118239227\|118244965	EIF4A3	1	0	1
chr12:118239227\|118244965	TARDBP	1	0	0

CircRNA Information