CircNet

General Information

circRNA Basic Information

CircID	chr12:28304626\|28484165
Strand	+
CircType	exon
Host Gene	ENSG00000123106.10;
Algorism	find_circ;CIRI2;DCC;
Sequence	GGAAACATGCAATTTTCATTGTGAGCTGCCTTCCAGAGTTTATGGTAGAACTTCACTGAAGTTGCTGATGCCAATGTGGAATAAAGGAAACTGTTAAGGCAGCAATAATAGAAGAGCAGAAACGAAGTGAAAAGGCTGTGGAAGAGGCAGTGAAAAGAACAAGAGATGAATTGATAGAGTATATAAAAGAACAGAAAAGG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr12:28304626\|28484165	NOP56	2	2	0
chr12:28304626\|28484165	ELAVL1	2	3	1
chr12:28304626\|28484165	PRPF8	1	0	0
chr12:28304626\|28484165	YTHDF1	0	1	0
chr12:28304626\|28484165	UPF1	1	1	0
chr12:28304626\|28484165	TROVE2	1	0	0
chr12:28304626\|28484165	FUS	0	1	0
chr12:28304626\|28484165	NOP58	1	2	0
chr12:28304626\|28484165	SRSF3	1	0	0
chr12:28304626\|28484165	ADAR	1	0	0
chr12:28304626\|28484165	U2AF2	12	4	0
chr12:28304626\|28484165	DDX54	0	1	4
chr12:28304626\|28484165	HNRNPL	2	1	0
chr12:28304626\|28484165	HNRNPC	3	0	0
chr12:28304626\|28484165	TRA2A	0	0	1
chr12:28304626\|28484165	SMNDC1	1	0	0
chr12:28304626\|28484165	HNRNPA1	2	0	0
chr12:28304626\|28484165	IGF2BP2	3	0	2
chr12:28304626\|28484165	RBFOX2	0	1	0
chr12:28304626\|28484165	AGO2	1	0	0
chr12:28304626\|28484165	EIF4A3	0	1	2
chr12:28304626\|28484165	FBL	1	0	0

CircRNA Information