CircNet

General Information

circRNA Basic Information

CircID	chr12:62585294\|62588156
Strand	+
CircType	exon
Host Gene	ENSG00000061987.14;
Algorism	find_circ;CIRI2;DCC;
Sequence	GCAACAAGTAACAGAAATTATATTTGTTTTAAAAGCAGTCAGTACTCTTATTGATTCACTTAAGAAAACTCAGCCTGAGAATG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr12:62585294\|62588156	ELAVL1	0	14	0
chr12:62585294\|62588156	NOP56	0	2	1
chr12:62585294\|62588156	SRSF1	1	0	0
chr12:62585294\|62588156	NOP58	1	2	0
chr12:62585294\|62588156	HNRNPC	0	5	0
chr12:62585294\|62588156	ACIN1	1	0	0
chr12:62585294\|62588156	SRSF9	1	0	0
chr12:62585294\|62588156	DDX54	2	1	1
chr12:62585294\|62588156	RBFOX2	0	1	0
chr12:62585294\|62588156	TARDBP	0	1	0
chr12:62585294\|62588156	FBL	0	1	0
chr12:62585294\|62588156	HNRNPL	1	0	0
chr12:62585294\|62588156	TAF15	0	1	0
chr12:62585294\|62588156	RBM22	0	1	0
chr12:62585294\|62588156	U2AF2	6	12	0
chr12:62585294\|62588156	IGF2BP2	1	2	0
chr12:62585294\|62588156	TRA2A	0	1	0
chr12:62585294\|62588156	EIF4A3	2	1	1
chr12:62585294\|62588156	AGO2	0	1	1

CircRNA Information