CircRNA Information

General Information
circRNA Basic Information
CircID chr13:32236078|32237986
Strand +
CircType exon
Host Gene ENSG00000073910.19;
Algorism find_circ;CIRI2;DCC;
Sequence GGTTATGTAATGGAAGCGCTCCTAACCTTGGAGGCGGCTGTGGATAACTTGTCTGACTGCTTGAAGAACAGTGACCTCCTAACTGTATTGTCCCG
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
chr13:32236078|32237986 hsa-miR-154-5p 0 1 1
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

    by mir_boxplot.py


circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr13:32236078|32237986 HNRNPC 0 1 0
chr13:32236078|32237986 SRSF1 0 0 1
chr13:32236078|32237986 ELAVL3 0 2 0
chr13:32236078|32237986 PRPF8 0 2 0
chr13:32236078|32237986 TAF15 1 0 0
chr13:32236078|32237986 PTBP1 1 0 1
chr13:32236078|32237986 IGF2BP2 0 0 1
chr13:32236078|32237986 EIF4A3 4 0 2