CircNet

General Information

circRNA Basic Information

CircID	chr13:35048563\|35232619
Strand	+
CircType	exon
Host Gene	ENSG00000172915.18;
Algorism	find_circ;CIRI2;CIRC
Sequence	GCAATTGCCTTGCCTCCTATTGCAAAGTGGCCTTATCAGAATGGCTTCACCTTAAACACTTGGTTTCGTATGGATCCATTAAATAATATTAATGTTGATAAGGATAAACCTTATCTTTATTGTTTTCGTACTAGCAAAGGAGTTGGTTACTCTGCTCATTTTGTTGGCAACTGTTTAATAGTCACATCATTGAAGTCCAAAGGAAAAGGTTTTCAGCATTGTGTGAAATATGATTTTCAACCACGCAAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr13:35048563\|35232619	ELAVL1	3	3	0
chr13:35048563\|35232619	FBL	0	1	0
chr13:35048563\|35232619	BUD13	1	0	0
chr13:35048563\|35232619	NOP58	0	2	1
chr13:35048563\|35232619	SF3B4	1	0	0
chr13:35048563\|35232619	HNRNPA1	0	1	0
chr13:35048563\|35232619	U2AF2	0	0	1
chr13:35048563\|35232619	CSTF2T	0	0	1
chr13:35048563\|35232619	NOP56	0	1	0
chr13:35048563\|35232619	DDX54	0	0	5
chr13:35048563\|35232619	FUS	1	1	0
chr13:35048563\|35232619	TARDBP	1	0	0
chr13:35048563\|35232619	RBM10	2	2	0
chr13:35048563\|35232619	TIAL1	0	1	0
chr13:35048563\|35232619	TAF15	1	1	0
chr13:35048563\|35232619	MOV10	0	2	0
chr13:35048563\|35232619	IGF2BP2	2	1	0
chr13:35048563\|35232619	HNRNPD	1	0	0
chr13:35048563\|35232619	EIF4A3	1	4	3
chr13:35048563\|35232619	AGO2	2	0	2

CircRNA Information