CircNet

General Information

circRNA Basic Information

CircID	chr13:49540876\|49541827
Strand	-
CircType	exon
Host Gene	ENSG00000136144.11;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTCTTCTGGATTTGGCGACATCTTACTGTGAAAACAGACTGAAAAAACTTTGTCAGCACATTATCAAGAGAGGAATTACTGTGGAGAATGCCTTTTCGCTATTCTCTGCTGCAGTCAGATATGATGCAGAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr13:49540876\|49541827	NOP56	0	1	0
chr13:49540876\|49541827	MOV10	0	2	0
chr13:49540876\|49541827	ELAVL1	16	5	0
chr13:49540876\|49541827	CELF2	0	1	0
chr13:49540876\|49541827	UPF1	1	0	0
chr13:49540876\|49541827	SRSF10	0	1	0
chr13:49540876\|49541827	TAF15	1	0	0
chr13:49540876\|49541827	FMR1	0	1	3
chr13:49540876\|49541827	CPSF3	0	1	0
chr13:49540876\|49541827	FUS	1	2	0
chr13:49540876\|49541827	SRSF7	0	0	1
chr13:49540876\|49541827	SRSF1	3	8	0
chr13:49540876\|49541827	NOP58	1	0	2
chr13:49540876\|49541827	U2AF2	6	4	0
chr13:49540876\|49541827	RBM10	0	1	0
chr13:49540876\|49541827	FIP1L1	0	2	0
chr13:49540876\|49541827	PTBP1	32	35	0
chr13:49540876\|49541827	HNRNPC	15	8	0
chr13:49540876\|49541827	SUGP2	0	1	0
chr13:49540876\|49541827	ZNF184	1	0	0
chr13:49540876\|49541827	HNRNPA1	15	14	0
chr13:49540876\|49541827	LIN28B	2	1	0
chr13:49540876\|49541827	FXR1	0	0	1
chr13:49540876\|49541827	IGF2BP2	0	0	1
chr13:49540876\|49541827	TARDBP	1	2	0
chr13:49540876\|49541827	CSTF2T	2	2	0
chr13:49540876\|49541827	CSTF2	2	0	0
chr13:49540876\|49541827	DKC1	1	0	0
chr13:49540876\|49541827	FBL	0	0	1
chr13:49540876\|49541827	ATXN2	1	0	0
chr13:49540876\|49541827	EWSR1	0	1	0
chr13:49540876\|49541827	EIF4A3	0	1	2
chr13:49540876\|49541827	AGO2	0	0	2

CircRNA Information