CircRNA Information

General Information
circRNA Basic Information
CircID chr14:37265207|37369624
Strand +
CircType exon
Host Gene ENSG00000151338.18;
Algorism find_circ;CIRI2;DCC;
Sequence TTTGCTACTTCGCATATCCCTACTTGACCTTTTTTGGAGCAAATGCCTTTGTGAAGTCTTCCTAGAGTCTTCCAGGCTAGAAAATATTAACCCTGAAGAAAATGACATGTGCAAACGGTTAGAGCAGGAGCTTCATCATGTGAAAGAGCAGAACCAGACTTCAGCAAACAACATGAGACATCTGACTGCTGAAAACAATCAAGAACGTGCTCTGAAG
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr14:37265207|37369624 NOP56 0 4 0
chr14:37265207|37369624 ELAVL1 6 3 0
chr14:37265207|37369624 CNBP 1 0 0
chr14:37265207|37369624 TAF15 0 1 0
chr14:37265207|37369624 SRSF7 0 0 1
chr14:37265207|37369624 SRSF1 0 2 1
chr14:37265207|37369624 NOP58 2 3 2
chr14:37265207|37369624 U2AF2 10 12 0
chr14:37265207|37369624 RBM10 0 1 0
chr14:37265207|37369624 FIP1L1 1 0 0
chr14:37265207|37369624 PTBP1 2 0 0
chr14:37265207|37369624 TRA2A 0 1 1
chr14:37265207|37369624 SMNDC1 0 0 1
chr14:37265207|37369624 HNRNPA1 1 0 0
chr14:37265207|37369624 IGF2BP3 0 1 0
chr14:37265207|37369624 IGF2BP2 0 1 2
chr14:37265207|37369624 BUD13 0 1 3
chr14:37265207|37369624 PRPF8 0 3 1
chr14:37265207|37369624 CSTF2T 3 0 0
chr14:37265207|37369624 TIA1 0 1 0
chr14:37265207|37369624 DKC1 1 0 0
chr14:37265207|37369624 EIF4A3 0 3 3
chr14:37265207|37369624 FBL 0 1 0