CircRNA Information

General Information
circRNA Basic Information
CircID chr14:60458678|60468536
Strand -
CircType exon
Host Gene ENSG00000179008.8;
Algorism find_circ;CIRI2;DCC;
Sequence CAGATATCTAGGCATAATGAAACTAAGGCTCTTTCAGAAACTCTGGAAGAAAAGAACAAAAATACAGAAAACAGAAAAGAACTGAAAGAAAGATGCTGAGTATGGAGATAAAGGGACAGTAAGACAAGTAAGAGAATCAAAATGTACTTCACAA
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr14:60458678|60468536 ELAVL1 1 9 0
chr14:60458678|60468536 TAF15 0 2 0
chr14:60458678|60468536 CPSF7 0 1 0
chr14:60458678|60468536 NUDT21 0 3 0
chr14:60458678|60468536 FUS 1 1 0
chr14:60458678|60468536 NOP58 0 1 2
chr14:60458678|60468536 U2AF2 2 1 0
chr14:60458678|60468536 PCBP2 2 0 0
chr14:60458678|60468536 HNRNPM 1 2 0
chr14:60458678|60468536 FIP1L1 1 0 0
chr14:60458678|60468536 PTBP1 10 2 0
chr14:60458678|60468536 HNRNPC 15 14 0
chr14:60458678|60468536 ZC3H7B 0 1 0
chr14:60458678|60468536 HNRNPA1 1 4 0
chr14:60458678|60468536 LIN28B 0 1 0
chr14:60458678|60468536 FXR1 0 1 0
chr14:60458678|60468536 IGF2BP2 0 1 2
chr14:60458678|60468536 TARDBP 4 0 0
chr14:60458678|60468536 YTHDC1 0 1 0
chr14:60458678|60468536 CSTF2T 4 4 0
chr14:60458678|60468536 SRRM4 0 1 0
chr14:60458678|60468536 CSTF2 2 3 0
chr14:60458678|60468536 WDR33 0 1 0
chr14:60458678|60468536 AGO4 0 1 0
chr14:60458678|60468536 FBL 0 0 1