CircNet

General Information

circRNA Basic Information

CircID	chr14:73879096\|73882438
Strand	+
CircType	exon
Host Gene	ENSG00000140043.11;
Algorism	find_circ;CIRI2;CIRC
Sequence	ATTAAAGAGACGGTAATAAATGGGTTGGAAAACATGGGAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr14:73879096\|73882438	KHSRP	1	0	0
chr14:73879096\|73882438	FUS	0	1	0
chr14:73879096\|73882438	KHDRBS1	1	0	0
chr14:73879096\|73882438	NOP56	0	2	0
chr14:73879096\|73882438	PRPF8	0	2	1
chr14:73879096\|73882438	UPF1	0	4	0
chr14:73879096\|73882438	FMR1	0	1	0
chr14:73879096\|73882438	ELAVL1	0	3	0
chr14:73879096\|73882438	DGCR8	0	1	0
chr14:73879096\|73882438	SRSF1	1	0	0
chr14:73879096\|73882438	U2AF1	1	0	0
chr14:73879096\|73882438	EIF3A	0	1	0
chr14:73879096\|73882438	U2AF2	12	1	0
chr14:73879096\|73882438	HNRNPU	0	0	1
chr14:73879096\|73882438	LSM11	0	1	0
chr14:73879096\|73882438	HNRNPA2B1	1	0	0
chr14:73879096\|73882438	HNRNPC	4	8	0
chr14:73879096\|73882438	HNRNPA1	1	0	0
chr14:73879096\|73882438	SND1	0	2	0
chr14:73879096\|73882438	IGF2BP2	1	2	0
chr14:73879096\|73882438	BUD13	0	1	0
chr14:73879096\|73882438	RBM47	2	0	0
chr14:73879096\|73882438	AGO2	1	1	0
chr14:73879096\|73882438	EIF4A3	0	1	1
chr14:73879096\|73882438	SSB	0	1	0

CircRNA Information