CircNet

General Information

circRNA Basic Information

CircID	chr14:89963108\|90033214
Strand	+
CircType	exon
Host Gene	ENSG00000042088.13;
Algorism	find_circ;CIRI2;CIRC
Sequence	GGTCTAGACAGTTTCAAAGTGAAACAGAAGTTCTTCGCTGGCAGCCAGGAGCCAATGGCCACCTTTCCTGTGCCATATGATTTGCCTCCAGAACTGTATGGAAGTAAAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr14:89963108\|90033214	U2AF2	1	0	0
chr14:89963108\|90033214	SRSF1	0	0	1
chr14:89963108\|90033214	ELAVL1	1	1	0
chr14:89963108\|90033214	PRPF8	0	1	0
chr14:89963108\|90033214	RBM10	0	2	0
chr14:89963108\|90033214	NOP56	2	2	0
chr14:89963108\|90033214	CSTF2T	1	0	0
chr14:89963108\|90033214	FUS	0	1	0
chr14:89963108\|90033214	FMR1	1	0	1
chr14:89963108\|90033214	METTL3	0	1	0
chr14:89963108\|90033214	UPF1	2	0	0
chr14:89963108\|90033214	IGF2BP1	0	0	2
chr14:89963108\|90033214	NOP58	0	1	0
chr14:89963108\|90033214	IGF2BP2	1	2	2
chr14:89963108\|90033214	AGO2	0	1	0
chr14:89963108\|90033214	EIF4A3	1	0	0
chr14:89963108\|90033214	FBL	3	0	0

CircRNA Information