CircNet

General Information

circRNA Basic Information

CircID	chr15:39996964\|40017242
Strand	+
CircType	exon
Host Gene	ENSG00000128829.11;
Algorism	find_circ;CIRI2;DCC;
Sequence	AAAGTGGATCTCTTCAGCCTGGGAATTATCTTCTTTGAGATGTCCTATCACCCCATGGTCACGGCTTCAGAAAGGATCTTTGTTCTCAACCAACTCAGAGATCCCACTTCGCCTAAGTTTCCAGAAGACTTTGACGATGGAGAGCATGCAAAGCAGGTCTTGATCAATTTGGGCTTGGTTTACAAGGTGCAGCAGCACAATGGAATCATCTTCCAGTTTGTGGCTTTCATCAAACGAAGGCAAAGGGCTGTACCTGAAATCCTCGCAGCTGGAGGCAGATATGACCTGCTG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr15:39996964\|40017242	U2AF2	12	2	3
chr15:39996964\|40017242	ELAVL1	1	0	0
chr15:39996964\|40017242	PRPF8	0	2	1
chr15:39996964\|40017242	FMR1	0	1	1
chr15:39996964\|40017242	SRSF7	0	1	0
chr15:39996964\|40017242	SRSF1	0	0	1
chr15:39996964\|40017242	U2AF1	0	1	0
chr15:39996964\|40017242	KHSRP	2	0	0
chr15:39996964\|40017242	SRSF9	0	1	1
chr15:39996964\|40017242	DDX54	1	0	3
chr15:39996964\|40017242	DDX55	1	0	0
chr15:39996964\|40017242	RBM10	1	0	0
chr15:39996964\|40017242	HNRNPC	0	1	0
chr15:39996964\|40017242	SMNDC1	0	0	1
chr15:39996964\|40017242	FXR1	0	0	1
chr15:39996964\|40017242	IGF2BP1	0	0	2
chr15:39996964\|40017242	IGF2BP2	4	1	4
chr15:39996964\|40017242	BUD13	0	0	1
chr15:39996964\|40017242	RBM47	0	0	1
chr15:39996964\|40017242	FBL	0	0	1
chr15:39996964\|40017242	ATXN2	1	0	0
chr15:39996964\|40017242	EIF4A3	2	0	6
chr15:39996964\|40017242	AGO2	0	0	1

CircRNA Information