CircNet

General Information

circRNA Basic Information

CircID	chr15:43441526\|43447485
Strand	-
CircType	exon
Host Gene	ENSG00000067369.13;
Algorism	find_circ;CIRI2;CIRC
Sequence	AAACCCCATTTCATTTCACTTTGCCTAAAGAAGGTGATATCATCCCACCATTGACTGGTGCAACCCCACCTCTTATTGGGCACCTAAAATTGGAGCCCAAGAGACACAGTACTCCTATTGAGCCTGCAACTGGTGAAAGAAAAAATGGATCTACTGCTGTTGCTGAGTCTGTTGCCAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan
chr15:43441526\|43447485	hsa-miR-144-5p	0	1	1

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr15:43441526\|43447485	ELAVL1	2	3	0
chr15:43441526\|43447485	CELF2	1	0	0
chr15:43441526\|43447485	PRPF8	0	1	1
chr15:43441526\|43447485	UPF1	0	1	0
chr15:43441526\|43447485	FMR1	0	2	3
chr15:43441526\|43447485	FUS	0	1	1
chr15:43441526\|43447485	DGCR8	0	0	2
chr15:43441526\|43447485	QKI	1	0	0
chr15:43441526\|43447485	SRSF1	0	0	1
chr15:43441526\|43447485	U2AF2	3	11	4
chr15:43441526\|43447485	DDX54	0	0	3
chr15:43441526\|43447485	RBM10	0	1	0
chr15:43441526\|43447485	HNRNPM	1	0	0
chr15:43441526\|43447485	PTBP1	0	0	1
chr15:43441526\|43447485	HNRNPC	0	6	0
chr15:43441526\|43447485	DHX9	0	1	0
chr15:43441526\|43447485	SMNDC1	0	0	1
chr15:43441526\|43447485	ACIN1	0	0	1
chr15:43441526\|43447485	FXR1	0	2	2
chr15:43441526\|43447485	FXR2	0	1	1
chr15:43441526\|43447485	IGF2BP1	0	0	1
chr15:43441526\|43447485	IGF2BP3	0	0	1
chr15:43441526\|43447485	IGF2BP2	0	0	1
chr15:43441526\|43447485	HNRNPUL1	0	1	0
chr15:43441526\|43447485	TARDBP	2	4	0
chr15:43441526\|43447485	CSTF2T	0	0	1
chr15:43441526\|43447485	RBM22	0	2	0
chr15:43441526\|43447485	FBL	0	1	1
chr15:43441526\|43447485	EIF4A3	3	3	3
chr15:43441526\|43447485	AGO2	0	1	1

CircRNA Information