CircNet

General Information

circRNA Basic Information

CircID	chr15:70666724\|70672001
Strand	-
CircType	exon
Host Gene	ENSG00000137831.14;
Algorism	find_circ;CIRI2;CIRC
Sequence	AGTGATCATTTAGGATCAGGAAGTCATTTCAGTAACCGAAAAGAAGATATGCTTCTTAAACAAGGTCAGATGTATATGGCAGACTCACAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr15:70666724\|70672001	ELAVL1	6	1	0
chr15:70666724\|70672001	CNBP	1	0	0
chr15:70666724\|70672001	UPF1	1	0	0
chr15:70666724\|70672001	TAF15	0	1	0
chr15:70666724\|70672001	FMR1	0	0	1
chr15:70666724\|70672001	NUDT21	1	0	0
chr15:70666724\|70672001	FUS	2	0	0
chr15:70666724\|70672001	NOP58	1	0	0
chr15:70666724\|70672001	U2AF2	9	0	4
chr15:70666724\|70672001	DDX54	0	3	0
chr15:70666724\|70672001	RBM10	2	0	0
chr15:70666724\|70672001	SF3A3	1	0	0
chr15:70666724\|70672001	PTBP1	9	5	0
chr15:70666724\|70672001	DHX9	1	0	0
chr15:70666724\|70672001	ZC3H7B	1	0	0
chr15:70666724\|70672001	TARDBP	3	0	0
chr15:70666724\|70672001	GTF2F1	0	1	0
chr15:70666724\|70672001	PRPF8	0	1	1
chr15:70666724\|70672001	CSTF2T	1	1	0
chr15:70666724\|70672001	DKC1	0	1	0
chr15:70666724\|70672001	FBL	1	0	0
chr15:70666724\|70672001	ATXN2	1	0	0
chr15:70666724\|70672001	EIF4A3	1	2	1
chr15:70666724\|70672001	AGO2	1	1	0

CircRNA Information