CircNet

General Information

circRNA Basic Information

CircID	chr15:76471212\|76621829
Strand	-
CircType	exon
Host Gene	ENSG00000140386.12;
Algorism	find_circ;CIRI2;DCC;
Sequence	GGCTAAGGAATATGAGAGTTTAATGGAAACCAAAAATTCTGGCTCTGATTCACCTTATAAAGCAAA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan
chr15:76471212\|76621829	hsa-miR-149-5p	0	1	1

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr15:76471212\|76621829	RBM5	1	0	0
chr15:76471212\|76621829	NOP56	1	0	0
chr15:76471212\|76621829	ELAVL1	2	2	0
chr15:76471212\|76621829	U2AF2	1	9	0
chr15:76471212\|76621829	CSTF2	0	7	0
chr15:76471212\|76621829	PRPF8	0	1	0
chr15:76471212\|76621829	TAF15	1	0	0
chr15:76471212\|76621829	DKC1	0	1	0
chr15:76471212\|76621829	RBM15B	0	2	0
chr15:76471212\|76621829	EIF4A3	1	2	2
chr15:76471212\|76621829	FBL	2	0	0

CircRNA Information