CircRNA Information

General Information
circRNA Basic Information
CircID chr17:29650654|29677741
Strand -
CircType exon
Host Gene ENSG00000141298.17;
Algorism find_circ;CIRI2;DCC;
Sequence TAGCACTTGTACCATGGGCTTAGTTTTGCCTCTCTGGAGCGACACGCTAATTCATTTGGATGGTGATGGTGGGTTCAGTGTATCGACGGATAACAGAGTTCACATATTCAAACCTGTATCTGTGCAGGCAATGTGGGTACGGTATATCTTGAATGTCACTCGAGAGATAGATAACTTCTTCCCAGGAGTCTTTGAGTATCATAACATTCGGGTATATGATGAAGAGGCAACGGATCTCCTGGCGTACTGGAATGACACTTACAAATTCATCTCTAAAGCAAA
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
chr17:29650654|29677741 hsa-miR-27a-5p 0 1 1
chr17:29650654|29677741 hsa-miR-10a-3p 0 1 1
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

    by mir_boxplot.py


    by mir_boxplot.py


circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr17:29650654|29677741 DKC1 0 1 0
chr17:29650654|29677741 IGF2BP2 5 1 1
chr17:29650654|29677741 SRSF1 0 0 1
chr17:29650654|29677741 NOP58 0 3 1
chr17:29650654|29677741 NOP56 1 1 0
chr17:29650654|29677741 MSI2 0 0 1
chr17:29650654|29677741 MSI1 1 0 0
chr17:29650654|29677741 U2AF2 6 0 1
chr17:29650654|29677741 LIN28B 0 0 1
chr17:29650654|29677741 DDX54 0 0 1
chr17:29650654|29677741 FUS 1 1 0
chr17:29650654|29677741 PRPF8 0 1 0
chr17:29650654|29677741 TAF15 1 0 0
chr17:29650654|29677741 SF3A3 1 0 0
chr17:29650654|29677741 FMR1 0 0 2
chr17:29650654|29677741 PTBP1 1 0 0
chr17:29650654|29677741 FBL 0 0 1
chr17:29650654|29677741 AGO2 0 0 1
chr17:29650654|29677741 EIF4A3 2 4 6
chr17:29650654|29677741 ELAVL1 0 1 1