CircNet

General Information

circRNA Basic Information

CircID	chr17:61715951\|61744591
Strand	-
CircType	exon
Host Gene	ENSG00000136492.8;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTTGAACTAAAACGACAATACAATGACCACCATTCAAAATTGAGAGGTCTTCTACCTGGCCGTCAGTGGTATGAAATTCAAGCATACAGGGCCTTAAACCAGGCCCTTGGTAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr17:61715951\|61744591	U2AF2	11	4	0
chr17:61715951\|61744591	FUS	1	0	0
chr17:61715951\|61744591	CNBP	0	1	0
chr17:61715951\|61744591	TAF15	0	1	0
chr17:61715951\|61744591	CPSF1	0	1	0
chr17:61715951\|61744591	ELAVL1	4	6	0
chr17:61715951\|61744591	DGCR8	1	0	0
chr17:61715951\|61744591	NOP58	3	3	1
chr17:61715951\|61744591	NOP56	3	2	0
chr17:61715951\|61744591	DDX54	4	3	3
chr17:61715951\|61744591	RBM10	1	1	0
chr17:61715951\|61744591	FIP1L1	1	0	0
chr17:61715951\|61744591	PTBP1	1	1	0
chr17:61715951\|61744591	HNRNPC	16	2	0
chr17:61715951\|61744591	DHX9	0	1	0
chr17:61715951\|61744591	HNRNPA1	3	0	0
chr17:61715951\|61744591	IGF2BP1	0	0	1
chr17:61715951\|61744591	IGF2BP2	2	2	1
chr17:61715951\|61744591	STAU1	0	1	0
chr17:61715951\|61744591	CSTF2T	1	2	1
chr17:61715951\|61744591	TARBP2	0	1	0
chr17:61715951\|61744591	AGO2	1	1	0
chr17:61715951\|61744591	EIF4A3	1	1	3
chr17:61715951\|61744591	FBL	1	1	0

CircRNA Information