CircRNA Information

General Information
circRNA Basic Information
CircID chr17:82763965|82884202
Strand +
CircType exon
Host Gene ENSG00000141556.20;
Algorism find_circ;CIRI2;CIRC
Sequence TGCACTGGTGATTGCTGCGGTGTTTGACCGAGACATAAACTGCAGAAGAGCAGCCTCT
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr17:82763965|82884202 AGGF1 0 16 0
chr17:82763965|82884202 U2AF2 10 0 1
chr17:82763965|82884202 MOV10 1 1 0
chr17:82763965|82884202 ELAVL1 5 1 0
chr17:82763965|82884202 TBRG4 2 0 0
chr17:82763965|82884202 CELF2 2 0 0
chr17:82763965|82884202 TNRC6A 0 4 2
chr17:82763965|82884202 FMR1 0 1 0
chr17:82763965|82884202 NUDT21 1 0 0
chr17:82763965|82884202 TIA1 0 1 0
chr17:82763965|82884202 FUS 0 1 0
chr17:82763965|82884202 NOP58 0 2 0
chr17:82763965|82884202 ADAR 2 0 0
chr17:82763965|82884202 NOP56 2 0 0
chr17:82763965|82884202 RBM10 1 1 0
chr17:82763965|82884202 HNRNPM 1 1 0
chr17:82763965|82884202 FIP1L1 1 1 0
chr17:82763965|82884202 PTBP1 0 11 0
chr17:82763965|82884202 HNRNPC 6 28 0
chr17:82763965|82884202 ZC3H7B 0 1 0
chr17:82763965|82884202 MSI2 1 0 0
chr17:82763965|82884202 LIN28B 0 3 4
chr17:82763965|82884202 FXR2 1 1 0
chr17:82763965|82884202 IGF2BP1 1 1 0
chr17:82763965|82884202 IGF2BP2 2 0 0
chr17:82763965|82884202 TARDBP 0 1 0
chr17:82763965|82884202 TAF15 0 1 0
chr17:82763965|82884202 GTF2F1 0 2 0
chr17:82763965|82884202 RBFOX2 1 0 0
chr17:82763965|82884202 CSTF2 0 1 0
chr17:82763965|82884202 RBM22 0 1 0
chr17:82763965|82884202 TIAL1 1 0 0
chr17:82763965|82884202 EIF4A3 2 8 2
chr17:82763965|82884202 FBL 2 2 0