CircNet

General Information

circRNA Basic Information

CircID	chr18:20954783\|20955245
Strand	-
CircType	exon
Host Gene	ENSG00000067900.7;
Algorism	find_circ;CIRI2;DCC;
Sequence	TAAACTGTTTCACGTTAGACCTGTAACCCAAGGAGATGTGTATAGAGCTGAAACTGAAGAAATTCCTAAAATATTCCAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr18:20954783\|20955245	HNRNPC	0	1	0
chr18:20954783\|20955245	NOP58	0	1	0
chr18:20954783\|20955245	U2AF2	9	0	0
chr18:20954783\|20955245	FUS	0	2	0
chr18:20954783\|20955245	TAF15	0	2	0
chr18:20954783\|20955245	AGO2	0	3	0
chr18:20954783\|20955245	PTBP1	2	0	0
chr18:20954783\|20955245	IGF2BP2	1	0	1
chr18:20954783\|20955245	EWSR1	0	1	0
chr18:20954783\|20955245	EIF4A3	0	0	3
chr18:20954783\|20955245	ELAVL1	4	2	0

CircRNA Information