CircNet

General Information

circRNA Basic Information

CircID	chr18:20954783\|20992937
Strand	-
CircType	exon
Host Gene	ENSG00000067900.7;
Algorism	find_circ;CIRI2;DCC;
Sequence	CTCGAATTACATCTTTACAAGAGGAGGTGAAGCATCTCAAACATAATCTCGAAAAAGTGGAAGGAGAAAGAAAAGAGGCTCAAGACATGCTTAATCACTCAGAAAAGTAAACTGTTTCACGTTAGACCTGTAACCCAAGGAGATGTGTATAGAGCTGAAACTGAAGAAATTCCTAAAATATTCCAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr18:20954783\|20992937	ELAVL1	2	2	0
chr18:20954783\|20992937	U2AF2	5	0	0
chr18:20954783\|20992937	SRSF1	2	0	1
chr18:20954783\|20992937	NOP58	2	1	2
chr18:20954783\|20992937	MSI2	0	0	1
chr18:20954783\|20992937	HNRNPC	0	1	0
chr18:20954783\|20992937	ACIN1	0	0	1
chr18:20954783\|20992937	CSTF2T	0	0	1
chr18:20954783\|20992937	LIN28B	1	0	3
chr18:20954783\|20992937	DDX54	1	0	4
chr18:20954783\|20992937	EWSR1	0	1	0
chr18:20954783\|20992937	FUS	0	2	0
chr18:20954783\|20992937	RBM10	1	0	0
chr18:20954783\|20992937	TAF15	0	2	0
chr18:20954783\|20992937	SF3B4	1	0	0
chr18:20954783\|20992937	IGF2BP2	3	0	4
chr18:20954783\|20992937	AGO2	1	3	0
chr18:20954783\|20992937	EIF4A3	3	0	5
chr18:20954783\|20992937	FBL	0	0	2

CircRNA Information