CircNet

General Information

circRNA Basic Information

CircID	chr18:36114097\|36116779
Strand	-
CircType	exon
Host Gene	ENSG00000141424.12;
Algorism	find_circ;CIRI2;DCC;
Sequence	AATCAGAAGAAACCTGAAAATGATGATGATGTGGAGATTAAGAAGCAGTTGTCCAAGTATGAATCTCAACTTTCAACAAATGAGGAGAAAGTAGATACAGATGATC

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan
chr18:36114097\|36116779	hsa-miR-216a-5p	0	1	1

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr18:36114097\|36116779	ELAVL1	0	4	1
chr18:36114097\|36116779	ZNF184	1	0	0
chr18:36114097\|36116779	HNRNPC	1	0	0
chr18:36114097\|36116779	BUD13	0	0	2
chr18:36114097\|36116779	NOP58	0	0	2
chr18:36114097\|36116779	HNRNPA1	0	2	0
chr18:36114097\|36116779	U2AF2	3	0	0
chr18:36114097\|36116779	CSTF2T	2	0	1
chr18:36114097\|36116779	LIN28B	0	4	1
chr18:36114097\|36116779	DDX54	1	0	5
chr18:36114097\|36116779	SAFB2	1	0	0
chr18:36114097\|36116779	FUS	1	0	0
chr18:36114097\|36116779	IGF2BP1	0	0	1
chr18:36114097\|36116779	HNRNPL	0	1	0
chr18:36114097\|36116779	AGO2	0	1	0
chr18:36114097\|36116779	FMR1	0	0	1
chr18:36114097\|36116779	PTBP1	0	0	1
chr18:36114097\|36116779	IGF2BP2	1	0	3
chr18:36114097\|36116779	TRA2A	0	0	1
chr18:36114097\|36116779	EIF4A3	3	1	2
chr18:36114097\|36116779	FBL	0	0	1

CircRNA Information