CircRNA Information

General Information
circRNA Basic Information
CircID chr1:173733713|173766289
Strand +
CircType exon
Host Gene ENSG00000076321.10;
Algorism find_circ;CIRI2;CIRC
Sequence GTATGACCCCAAAACAAACCAGTGGAGCAGTGATGTGGCCCCTACAAGCACCTGCAGGACAAGTGTTGGTGTAGCAGTACTTGGAGGCTTTCTTTATGCTGTGGGTGGCCAGGATGGTGTGTCTTGCCTCAACATTGTTGAGAG
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

    by mir_boxplot.py


    by mir_boxplot.py


    by mir_boxplot.py


circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr1:173733713|173766289 U2AF2 4 12 0
chr1:173733713|173766289 ELAVL1 0 1 2
chr1:173733713|173766289 NUMA1 0 1 0
chr1:173733713|173766289 NCBP3 0 1 0
chr1:173733713|173766289 UPF1 0 2 0
chr1:173733713|173766289 FMR1 0 0 2
chr1:173733713|173766289 NUDT21 0 1 0
chr1:173733713|173766289 FUS 0 1 0
chr1:173733713|173766289 SRSF1 1 0 1
chr1:173733713|173766289 NOP58 1 0 1
chr1:173733713|173766289 U2AF1 2 0 0
chr1:173733713|173766289 NOP56 0 2 0
chr1:173733713|173766289 SRSF9 0 0 1
chr1:173733713|173766289 DDX54 0 1 1
chr1:173733713|173766289 EIF3G 0 1 0
chr1:173733713|173766289 RBM10 1 1 0
chr1:173733713|173766289 FIP1L1 0 1 0
chr1:173733713|173766289 PTBP1 1 0 0
chr1:173733713|173766289 HNRNPC 0 11 0
chr1:173733713|173766289 SMNDC1 1 0 0
chr1:173733713|173766289 RANGAP1 0 0 1
chr1:173733713|173766289 LIN28B 0 0 2
chr1:173733713|173766289 FXR1 0 0 1
chr1:173733713|173766289 FXR2 0 1 1
chr1:173733713|173766289 IGF2BP1 0 0 1
chr1:173733713|173766289 IGF2BP2 2 1 0
chr1:173733713|173766289 EIF4G2 1 0 0
chr1:173733713|173766289 CSTF2T 1 1 0
chr1:173733713|173766289 NONO 0 1 0
chr1:173733713|173766289 RBM22 0 1 0
chr1:173733713|173766289 HNRNPK 0 1 0
chr1:173733713|173766289 EIF4A3 0 3 1
chr1:173733713|173766289 FBL 2 0 1