CircNet

General Information

circRNA Basic Information

CircID	chr1:21560626\|21570374
Strand	+
CircType	exon
Host Gene	ENSG00000162551.13;
Algorism	find_circ;CIRI2;DCC;
Sequence	CACTCCCACTTCATCTGGAACCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites
chr1:21560626\|21570374	DGCR8	0	1
chr1:21560626\|21570374	DROSHA	1	0
chr1:21560626\|21570374	BUD13	2	0
chr1:21560626\|21570374	RBFOX2	1	0
chr1:21560626\|21570374	SF3B4	1	0
chr1:21560626\|21570374	U2AF2	0	1
chr1:21560626\|21570374	CSTF2T	1	0
chr1:21560626\|21570374	GEMIN5	1	0
chr1:21560626\|21570374	EFTUD2	1	0
chr1:21560626\|21570374	PRPF8	2	0
chr1:21560626\|21570374	HNRNPK	4	0
chr1:21560626\|21570374	HNRNPA2B1	0	1
chr1:21560626\|21570374	HNRNPM	0	1
chr1:21560626\|21570374	EIF4G2	3	0
chr1:21560626\|21570374	DICER1	0	1
chr1:21560626\|21570374	HNRNPC	0	1
chr1:21560626\|21570374	FUS	0	4
chr1:21560626\|21570374	ILF3	1	0
chr1:21560626\|21570374	TARDBP	6	0

CircRNA Information