CircNet

General Information

circRNA Basic Information

CircID	chr1:229450525\|229475732
Strand	-
CircType	exon
Host Gene	ENSG00000069248.11;
Algorism	find_circ;CIRI2;DCC;
Sequence	AAGCACCTGGGTTCAGCAATACGTCACTGATTATCCTTCACCAGCTAGAAGACAAGATGAAAGCTCACTCTTTTCTTATGGACTTTATTCATCAA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr1:229450525\|229475732	NOP56	0	1	0
chr1:229450525\|229475732	ELAVL1	6	1	1
chr1:229450525\|229475732	SF3B4	1	0	0
chr1:229450525\|229475732	FMR1	3	0	1
chr1:229450525\|229475732	FUS	0	1	0
chr1:229450525\|229475732	DGCR8	0	0	1
chr1:229450525\|229475732	SRSF1	1	1	0
chr1:229450525\|229475732	NOP58	3	4	2
chr1:229450525\|229475732	ADAR	0	1	0
chr1:229450525\|229475732	U2AF2	9	9	0
chr1:229450525\|229475732	DDX54	0	0	2
chr1:229450525\|229475732	RBM10	1	3	0
chr1:229450525\|229475732	HNRNPA2B1	1	0	0
chr1:229450525\|229475732	PTBP1	3	0	1
chr1:229450525\|229475732	HNRNPC	43	0	0
chr1:229450525\|229475732	HNRNPD	2	0	0
chr1:229450525\|229475732	HNRNPA1	9	1	0
chr1:229450525\|229475732	FXR1	0	0	2
chr1:229450525\|229475732	FXR2	1	0	1
chr1:229450525\|229475732	IGF2BP1	0	0	1
chr1:229450525\|229475732	IGF2BP3	0	0	1
chr1:229450525\|229475732	IGF2BP2	3	2	2
chr1:229450525\|229475732	TARDBP	1	0	0
chr1:229450525\|229475732	FBL	3	2	1
chr1:229450525\|229475732	BUD13	0	1	0
chr1:229450525\|229475732	CSTF2T	1	0	0
chr1:229450525\|229475732	HNRNPK	1	0	0
chr1:229450525\|229475732	AGO2	0	0	2
chr1:229450525\|229475732	ATXN2	1	0	0
chr1:229450525\|229475732	EIF4A3	4	2	2
chr1:229450525\|229475732	SSB	1	0	0

CircRNA Information