CircNet

General Information

circRNA Basic Information

CircID	chr1:36358239\|36368084
Strand	-
CircType	exon
Host Gene	ENSG00000196182.10;
Algorism	CIRI2;DCC;find_circ;
Sequence	AGAACATCAGTTACTTTTATATGAAGAAAAATACAGGAACAGGCTGGAGTTCTGTGTTTTTGAGTCCATTATGGAAGGGTAAAGGCTACACTCCTAAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites
chr1:36358239\|36368084	ELAVL1	2	1
chr1:36358239\|36368084	DGCR8	1	0
chr1:36358239\|36368084	RBFOX2	0	1
chr1:36358239\|36368084	FUS	1	0
chr1:36358239\|36368084	IGF2BP2	0	3
chr1:36358239\|36368084	U2AF2	1	1
chr1:36358239\|36368084	PRPF8	0	3
chr1:36358239\|36368084	RBM22	0	1
chr1:36358239\|36368084	TAF15	1	0
chr1:36358239\|36368084	PTBP1	1	0
chr1:36358239\|36368084	TARDBP	0	1
chr1:36358239\|36368084	AGO2	0	1
chr1:36358239\|36368084	EIF4A3	1	1
chr1:36358239\|36368084	FBL	3	3

CircRNA Information