CircNet

General Information

circRNA Basic Information

CircID	chr1:53951986\|53962409
Strand	+
CircType	exon
Host Gene	ENSG00000116212.14;
Algorism	find_circ;CIRI2;DCC;
Sequence	GACATCAAAACCGTCAAGCACAAGCTCCAGACCCACATAGGCCTTGTTCACTCCAAAGTGCCTTTGAAGGAATTTGATCATAGTAACTGCAAGACAGAGGGCTGGGCTGACCAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr1:53951986\|53962409	ELAVL1	0	1	0
chr1:53951986\|53962409	PRPF8	0	1	0
chr1:53951986\|53962409	UPF1	1	0	0
chr1:53951986\|53962409	TAF15	0	2	0
chr1:53951986\|53962409	FMR1	0	3	1
chr1:53951986\|53962409	FUS	1	0	0
chr1:53951986\|53962409	DGCR8	0	1	0
chr1:53951986\|53962409	SRSF1	0	1	0
chr1:53951986\|53962409	NONO	0	1	0
chr1:53951986\|53962409	U2AF2	3	1	0
chr1:53951986\|53962409	HNRNPK	0	1	0
chr1:53951986\|53962409	HNRNPA2B1	0	4	0
chr1:53951986\|53962409	SF3A3	1	0	0
chr1:53951986\|53962409	PTBP1	0	4	1
chr1:53951986\|53962409	HNRNPC	1	0	0
chr1:53951986\|53962409	RANGAP1	1	0	0
chr1:53951986\|53962409	BCCIP	0	1	0
chr1:53951986\|53962409	IGF2BP1	0	0	1
chr1:53951986\|53962409	IGF2BP3	1	0	1
chr1:53951986\|53962409	IGF2BP2	0	1	1
chr1:53951986\|53962409	RBFOX2	1	0	0
chr1:53951986\|53962409	FXR2	0	1	0
chr1:53951986\|53962409	RBM22	0	1	0
chr1:53951986\|53962409	FBL	0	0	1
chr1:53951986\|53962409	AGO1	1	0	1
chr1:53951986\|53962409	EIF4A3	2	6	2
chr1:53951986\|53962409	AGO2	2	1	0

CircRNA Information