CircNet

General Information

circRNA Basic Information

CircID	chr20:20495117\|20591314
Strand	-
CircType	exon
Host Gene	ENSG00000188559.13;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTCAAAAGGCAGAAAACACACAGAATTCGAGTTCTTCAGAGCCTCAGCCTATTCAAGAGAATAAAGGACATGTGAAGAGAGAACATGAAGGAATAACA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan
chr20:20495117\|20591314	hsa-miR-22-5p	0	1	1

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr20:20495117\|20591314	FKBP4	0	1	0
chr20:20495117\|20591314	HNRNPC	0	1	0
chr20:20495117\|20591314	SRSF1	0	0	1
chr20:20495117\|20591314	ELAVL1	1	1	0
chr20:20495117\|20591314	DDX3X	2	0	0
chr20:20495117\|20591314	U2AF2	2	2	0
chr20:20495117\|20591314	DKC1	1	0	0
chr20:20495117\|20591314	DDX54	0	0	2
chr20:20495117\|20591314	FUS	2	0	0
chr20:20495117\|20591314	PRPF8	0	1	0
chr20:20495117\|20591314	TARDBP	1	2	0
chr20:20495117\|20591314	TAF15	1	0	0
chr20:20495117\|20591314	SF3A3	1	0	0
chr20:20495117\|20591314	CPSF7	0	1	0
chr20:20495117\|20591314	BUD13	1	0	0
chr20:20495117\|20591314	PTBP1	0	9	0
chr20:20495117\|20591314	IGF2BP2	0	0	2
chr20:20495117\|20591314	AGO2	0	1	0
chr20:20495117\|20591314	EIF4A3	1	1	2
chr20:20495117\|20591314	NOP58	0	0	1

CircRNA Information