CircNet

General Information

circRNA Basic Information

CircID	chr20:62256116\|62284169
Strand	+
CircType	exon
Host Gene	ENSG00000130703.15;
Algorism	CIRI2;DCC;
Sequence	ATGTGGATCAGATACGATGATTCAGTAGAAGAGCACATGTCAGGGGCAGTGGAGGCTGGCTGCTGAAGGATGAACGGAGAGGAAGAATTCTTTGATGCCGTCACAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr20:62256116\|62284169	NOP56	1	1	0
chr20:62256116\|62284169	MOV10	1	0	0
chr20:62256116\|62284169	FUS	0	1	0
chr20:62256116\|62284169	PRPF8	0	2	0
chr20:62256116\|62284169	FMR1	0	1	0
chr20:62256116\|62284169	ELAVL1	1	6	0
chr20:62256116\|62284169	DGCR8	0	1	0
chr20:62256116\|62284169	SRSF7	1	0	0
chr20:62256116\|62284169	SRSF1	1	4	2
chr20:62256116\|62284169	NOP58	0	1	1
chr20:62256116\|62284169	U2AF1	0	1	0
chr20:62256116\|62284169	U2AF2	2	14	0
chr20:62256116\|62284169	DDX54	1	1	3
chr20:62256116\|62284169	HNRNPC	0	7	0
chr20:62256116\|62284169	TRA2A	1	0	1
chr20:62256116\|62284169	DDX3X	2	0	2
chr20:62256116\|62284169	AUH	0	1	0
chr20:62256116\|62284169	HNRNPA1	0	5	0
chr20:62256116\|62284169	FXR2	0	0	1
chr20:62256116\|62284169	IGF2BP2	0	0	2
chr20:62256116\|62284169	RBFOX2	0	1	0
chr20:62256116\|62284169	RBM22	0	1	0
chr20:62256116\|62284169	EIF4A3	2	2	2
chr20:62256116\|62284169	AGO2	0	1	0

CircRNA Information