CircNet

General Information

circRNA Basic Information

CircID	chr20:8740344\|8789575
Strand	+
CircType	exon
Host Gene	ENSG00000182621.17;
Algorism	find_circ;CIRI2;DCC;
Sequence	GGAGAAGACAGAGATGATCCGGTCATATATCCAGGAAGTGGTGCAGTATATCAAGAGG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr20:8740344\|8789575	U2AF2	0	1	0
chr20:8740344\|8789575	CSTF2T	1	0	1
chr20:8740344\|8789575	DDX54	2	2	1
chr20:8740344\|8789575	TIA1	0	1	0
chr20:8740344\|8789575	PRPF8	0	1	0
chr20:8740344\|8789575	IGF2BP3	0	1	0
chr20:8740344\|8789575	IGF2BP2	0	1	0
chr20:8740344\|8789575	EIF4A3	2	3	2

CircRNA Information