CircNet

General Information

circRNA Basic Information

CircID	chr21:31968250\|31974717
Strand	+
CircType	exon
Host Gene	ENSG00000142149.8;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTGCCATCAGTTTCCTGCGCTCTCTCCTGGAACCGGATCCTGTGAAGAGGCCAAATATTCAGCAGGCACTGGCGAATCGCTGGCTTAATGAGAATTACACGGGCAAAGTGCCCTGTAATGTCACCTATCCCAACAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr21:31968250\|31974717	DGCR8	2	0	0
chr21:31968250\|31974717	HNRNPC	28	84	2
chr21:31968250\|31974717	MOV10	0	1	0
chr21:31968250\|31974717	NOP58	0	0	1
chr21:31968250\|31974717	HNRNPA1	2	2	0
chr21:31968250\|31974717	U2AF2	1	0	0
chr21:31968250\|31974717	LIN28B	0	1	0
chr21:31968250\|31974717	PRPF8	0	2	0
chr21:31968250\|31974717	TARDBP	0	3	0
chr21:31968250\|31974717	RBM10	1	0	0
chr21:31968250\|31974717	PTBP1	1	0	0
chr21:31968250\|31974717	IGF2BP2	0	0	1
chr21:31968250\|31974717	ELAVL1	6	8	0

CircRNA Information