CircNet

General Information

circRNA Basic Information

CircID	chr22:17497403\|17499549
Strand	+
CircType	exon
Host Gene	ENSG00000099954.18;
Algorism	find_circ;CIRI2;DCC;
Sequence	GCCTCAGACATTCCACAGCTACCTAGAGGACATCATCAACTACCGCTGGGAGCTCGAAGAAGGGAAGCCCAACCCTCTGAGGGAAGCCAGTTTCCAGGACCTGCCTCTTCGCACACGGGTGGAGATCCTGCACCGACTCTGTGATTACCGGCTGGATGCAGACGATGTCTTCGATCTTCTAAAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr22:17497403\|17499549	AGGF1	0	0	2
chr22:17497403\|17499549	NOP56	1	0	0
chr22:17497403\|17499549	ELAVL1	4	4	1
chr22:17497403\|17499549	TAF15	0	1	0
chr22:17497403\|17499549	FMR1	0	0	1
chr22:17497403\|17499549	NUDT21	1	0	0
chr22:17497403\|17499549	CPSF3	1	0	0
chr22:17497403\|17499549	CPSF1	1	0	1
chr22:17497403\|17499549	NOP58	0	0	2
chr22:17497403\|17499549	ADAR	0	1	0
chr22:17497403\|17499549	U2AF2	6	8	0
chr22:17497403\|17499549	RBM10	0	1	0
chr22:17497403\|17499549	FIP1L1	2	1	0
chr22:17497403\|17499549	PTBP1	3	0	0
chr22:17497403\|17499549	HNRNPC	11	14	0
chr22:17497403\|17499549	HNRNPA1	4	0	0
chr22:17497403\|17499549	TARDBP	1	0	0
chr22:17497403\|17499549	STAU1	0	1	0
chr22:17497403\|17499549	RBFOX2	4	1	0
chr22:17497403\|17499549	CSTF2T	1	0	0
chr22:17497403\|17499549	CSTF2	2	0	0
chr22:17497403\|17499549	EWSR1	0	1	0
chr22:17497403\|17499549	EIF4A3	0	0	1
chr22:17497403\|17499549	FBL	0	2	2

CircRNA Information