CircNet

General Information

circRNA Basic Information

CircID	chr22:17541839\|17543003
Strand	+
CircType	exon
Host Gene	ENSG00000099954.18;
Algorism	find_circ;CIRI2;DCC;
Sequence	AGGCCAGCAGTACCAGGAACATTTGGCCCTCTGCGAGGATCAGATCCTGCCACCTTGTATGGCTCCTCTGGAGTCCCGGAGCCACACCCCGGGGAGCCTGTGCAGCAGCGTCAGCCTTTCACCATGCAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr22:17541839\|17543003	DHX9	0	1	0
chr22:17541839\|17543003	NOP56	1	2	0
chr22:17541839\|17543003	SRSF1	0	1	0
chr22:17541839\|17543003	ELAVL1	1	1	0
chr22:17541839\|17543003	RBM47	1	0	0
chr22:17541839\|17543003	IGF2BP2	0	1	0
chr22:17541839\|17543003	HNRNPA1	1	0	0
chr22:17541839\|17543003	CSTF2T	1	0	0
chr22:17541839\|17543003	LIN28B	0	1	0
chr22:17541839\|17543003	FUS	2	1	0
chr22:17541839\|17543003	TARDBP	0	1	0
chr22:17541839\|17543003	UPF1	0	3	0
chr22:17541839\|17543003	DKC1	1	1	0
chr22:17541839\|17543003	NOP58	2	0	0
chr22:17541839\|17543003	PTBP1	1	1	0
chr22:17541839\|17543003	HNRNPC	1	8	0
chr22:17541839\|17543003	CPSF3	1	0	0
chr22:17541839\|17543003	ADAR	0	1	0
chr22:17541839\|17543003	U2AF2	0	1	0
chr22:17541839\|17543003	FBL	0	0	1

CircRNA Information