CircNet

General Information

circRNA Basic Information

CircID	chr2:162394389\|162504657
Strand	-
CircType	exon
Host Gene	ENSG00000184611.11;
Algorism	find_circ;CIRI2;DCC;
Sequence	GGCCTTTTAATCATATCAAGTCAAGCCTCCTGGGATCCACATCAGATTCAAACCTCAACAAATACAGCACCATTAACAAGATTCCACAGCTCACTCTGAATTTTTCAGAGGTCAAAACTGAGAAAAAGAATTCATCACCTCCTTCTTCAGATAAAACCATTATTGCACCCAAGGTTAAAGATCGAACACACAATGTGACTGAGAAAGTGACCCAGGCTGATCTCCTACGATCACAATCCATGAATGATTCAGAAGGAGACAACTGTAAACTAAGAAGAAGGAAATTGTCATTTGAAAGTGAAGGAGAGAAAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Downstream Sites	Number of Circ Exons Sites
chr2:162394389\|162504657	TAF15	1	0
chr2:162394389\|162504657	CSTF2T	0	2
chr2:162394389\|162504657	NOP58	1	0
chr2:162394389\|162504657	DDX54	0	6
chr2:162394389\|162504657	ELAVL1	1	0

CircRNA Information