CircNet

General Information

circRNA Basic Information

CircID	chr2:181493325\|181527387
Strand	+
CircType	exon
Host Gene	ENSG00000115232.13;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTTTGTAAACCCAACTTCATTTGTGTATGGATCAAATGATGAAAATGAGCCTGAAACGTGCATGGTGGAGAAAATGAACTTAACTTTCCAT

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites
chr2:181493325\|181527387	NOP56	0	1
chr2:181493325\|181527387	FBL	0	1
chr2:181493325\|181527387	MSI2	1	0
chr2:181493325\|181527387	U2AF2	1	0
chr2:181493325\|181527387	CELF2	1	2
chr2:181493325\|181527387	CSTF2	1	0
chr2:181493325\|181527387	RBM10	1	0
chr2:181493325\|181527387	HNRNPL	0	1
chr2:181493325\|181527387	DKC1	0	1
chr2:181493325\|181527387	FMR1	1	0
chr2:181493325\|181527387	HNRNPC	1	0
chr2:181493325\|181527387	TARDBP	0	2

CircRNA Information