CircRNA Information

General Information
circRNA Basic Information
CircID chr2:200569663|200575461
Strand +
CircType exon
Host Gene ENSG00000163535.17;
Algorism find_circ;CIRI2;DCC;
Sequence GTGATAGACCATTACAGGACTTGTCAAATACCAGTTTTGTTTCAAATAACACTGCTGAATCTGAAAATAAGTCAGAAGATCTATCTTCAGAACGGACAAGCAGAAGAAGAAGGTGTACTCCTTTCTATTTTAAAGAGCCAAGCCTCAGAGA
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr2:200569663|200575461 KHSRP 0 5 0
chr2:200569663|200575461 ELAVL1 3 4 2
chr2:200569663|200575461 PRPF8 1 2 0
chr2:200569663|200575461 UPF1 0 1 0
chr2:200569663|200575461 FMR1 0 0 1
chr2:200569663|200575461 FUS 0 1 0
chr2:200569663|200575461 SRSF1 0 1 0
chr2:200569663|200575461 U2AF2 9 9 0
chr2:200569663|200575461 U2AF1 1 1 1
chr2:200569663|200575461 NOP56 1 2 0
chr2:200569663|200575461 HNRNPU 1 0 0
chr2:200569663|200575461 DDX54 0 0 3
chr2:200569663|200575461 HNRNPK 0 3 0
chr2:200569663|200575461 FIP1L1 1 0 0
chr2:200569663|200575461 HNRNPC 0 2 0
chr2:200569663|200575461 TRA2A 0 1 2
chr2:200569663|200575461 HNRNPA1 0 1 0
chr2:200569663|200575461 LARP7 0 1 0
chr2:200569663|200575461 SMNDC1 1 0 0
chr2:200569663|200575461 ACIN1 1 0 1
chr2:200569663|200575461 IGF2BP3 0 0 1
chr2:200569663|200575461 IGF2BP2 0 3 3
chr2:200569663|200575461 NOP58 0 1 1
chr2:200569663|200575461 RBM47 1 5 0
chr2:200569663|200575461 CSTF2T 0 2 1
chr2:200569663|200575461 CSTF2 1 3 0
chr2:200569663|200575461 RBM22 0 1 0
chr2:200569663|200575461 TIAL1 0 1 0
chr2:200569663|200575461 AGO2 0 1 0
chr2:200569663|200575461 EIF4A3 1 0 2
chr2:200569663|200575461 FBL 0 0 2