CircRNA Information

General Information
circRNA Basic Information
CircID chr2:218459790|218466176
Strand -
CircType exon
Host Gene ENSG00000135913.10;
Algorism find_circ;CIRI2;DCC;
Sequence GAGGCTTGGGAACAGAAAGAAGATGATGACCTCAAAAGAGCTACCGAGTTAAGTCTTCAAGAGTTTAACAACTCCTTTGTGGATGCATTGGGTTCTGATGAGGACTCTGGAAATGAGGATGTTTTTGATATGGAGTACACAGAAGCTGAAGCTGAGGAACTGAAAAGAAATGCTGAG
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
chr2:218459790|218466176 hsa-miR-127-5p 0 1 1
chr2:218459790|218466176 hsa-miR-152-5p 0 1 1
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

    by mir_boxplot.py


    by mir_boxplot.py


circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr2:218459790|218466176 GTF2F1 1 0 0
chr2:218459790|218466176 FBL 0 1 1
chr2:218459790|218466176 SRSF1 0 1 1
chr2:218459790|218466176 ELAVL1 0 3 1
chr2:218459790|218466176 U2AF1 0 0 1
chr2:218459790|218466176 U2AF2 1 3 0
chr2:218459790|218466176 CSTF2T 0 0 1
chr2:218459790|218466176 NOP56 1 0 0
chr2:218459790|218466176 DDX54 0 1 2
chr2:218459790|218466176 FUS 1 0 0
chr2:218459790|218466176 PRPF8 0 1 1
chr2:218459790|218466176 RBM10 0 3 0
chr2:218459790|218466176 HNRNPL 0 1 0
chr2:218459790|218466176 CPSF6 0 0 1
chr2:218459790|218466176 BUD13 1 0 1
chr2:218459790|218466176 IGF2BP2 0 5 2
chr2:218459790|218466176 EIF4A3 2 2 4
chr2:218459790|218466176 NOP58 1 2 1