CircNet

General Information

circRNA Basic Information

CircID	chr2:39278407\|39292826
Strand	-
CircType	exon
Host Gene	ENSG00000011566.14;
Algorism	CIRI2;find_circ;DCC;
Sequence	AGGACACGTCGCACATTTAGAAGATGATGAAGGAGATGATGATGAATCTAAACACTCAACTCTGAAAGCAAAAATTCCACCTCCTTTGCCACCAAAGATCAGTACTTGATATTTGGTGCCGAAGAAGGGATTTATACCCTCAATCTTAATGAACTTCATGAAACATCAATGGAACAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr2:39278407\|39292826	NOP56	1	2	0
chr2:39278407\|39292826	ELAVL1	3	3	1
chr2:39278407\|39292826	ELAVL3	1	1	0
chr2:39278407\|39292826	PRPF8	3	0	0
chr2:39278407\|39292826	TAF15	4	0	0
chr2:39278407\|39292826	FUS	2	0	1
chr2:39278407\|39292826	SRSF7	0	1	0
chr2:39278407\|39292826	NOP58	1	0	1
chr2:39278407\|39292826	U2AF1	2	0	0
chr2:39278407\|39292826	U2AF2	24	2	1
chr2:39278407\|39292826	DDX54	0	4	7
chr2:39278407\|39292826	RBM10	5	0	0
chr2:39278407\|39292826	HNRNPC	0	1	0
chr2:39278407\|39292826	TRA2A	2	0	1
chr2:39278407\|39292826	HNRNPA1	0	1	0
chr2:39278407\|39292826	ACIN1	5	0	3
chr2:39278407\|39292826	IGF2BP3	1	0	0
chr2:39278407\|39292826	IGF2BP2	1	2	1
chr2:39278407\|39292826	BUD13	0	0	1
chr2:39278407\|39292826	RBM47	0	1	1
chr2:39278407\|39292826	EIF4G2	1	0	0
chr2:39278407\|39292826	CSTF2T	0	1	1
chr2:39278407\|39292826	VIM	2	0	0
chr2:39278407\|39292826	RBM22	0	1	0
chr2:39278407\|39292826	XRN2	1	0	0
chr2:39278407\|39292826	DKC1	0	1	0
chr2:39278407\|39292826	EIF4A3	3	0	6
chr2:39278407\|39292826	AGO2	1	0	0

CircRNA Information