CircRNA Information

General Information
circRNA Basic Information
CircID chr3:108646617|108669749
Strand +
CircType exon
Host Gene ENSG00000198919.12;
Algorism find_circ;CIRI2;DCC;
Sequence GAATTGCTCTACAGTCAATAACAGGCAGTCAGC
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr3:108646617|108669749 U2AF2 8 1 2
chr3:108646617|108669749 MOV10 0 1 0
chr3:108646617|108669749 ELAVL1 0 1 0
chr3:108646617|108669749 PRPF8 0 1 2
chr3:108646617|108669749 YTHDF2 0 2 0
chr3:108646617|108669749 FUS 3 1 0
chr3:108646617|108669749 NOP58 2 1 0
chr3:108646617|108669749 U2AF1 1 0 1
chr3:108646617|108669749 EIF3A 0 2 0
chr3:108646617|108669749 EIF3B 0 1 0
chr3:108646617|108669749 NOP56 1 1 0
chr3:108646617|108669749 EIF3G 0 1 0
chr3:108646617|108669749 HNRNPL 0 1 0
chr3:108646617|108669749 HNRNPC 2 0 0
chr3:108646617|108669749 LIN28B 0 1 0
chr3:108646617|108669749 LIN28A 0 1 0
chr3:108646617|108669749 IGF2BP2 1 2 0
chr3:108646617|108669749 YTHDC2 0 2 0
chr3:108646617|108669749 RBM47 1 0 0
chr3:108646617|108669749 METTL3 0 1 0
chr3:108646617|108669749 EIF4A3 1 0 0
chr3:108646617|108669749 FBL 2 1 0