CircNet

General Information

circRNA Basic Information

CircID	chr3:112221128\|112240006
Strand	-
CircType	exon
Host Gene	ENSG00000172139.14;
Algorism	find_circ;CIRI2;DCC;
Sequence	GCAAGCTACCAGAGACAATACAGGAATGAGATTCTGTCCCAGAGTGCTGTCCAGGTGTTGGTTGGTGCAGCAGAAAGTTTTGGTGAGAAGAAGGGAAA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites
chr3:112221128\|112240006	AGO2	1	0
chr3:112221128\|112240006	NOP56	0	1
chr3:112221128\|112240006	LIN28B	1	0
chr3:112221128\|112240006	CSTF2	1	0
chr3:112221128\|112240006	GRWD1	0	1
chr3:112221128\|112240006	TIA1	0	2
chr3:112221128\|112240006	HNRNPC	1	0
chr3:112221128\|112240006	TARDBP	2	0

CircRNA Information