CircNet

General Information

circRNA Basic Information

CircID	chr3:142365047\|142384685
Strand	-
CircType	exon
Host Gene	ENSG00000114127.10;
Algorism	CIRI2;
Sequence	CTACCTGAGAAGAAAAGGAATAATAATAAATGAAACATCTGCAGTTGTGTATGCTCAGTTACTCACAGGTCGTAAATATCAAATAAATCAAAATGGTGAAGTTCGTCTAGAGAAACAGTGGTCAAAACAAGTTGTTCCTTTTGTTTATCAAACTATTGTCAAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr3:142365047\|142384685	ELAVL1	3	1	0
chr3:142365047\|142384685	CELF2	0	1	0
chr3:142365047\|142384685	PRPF8	0	1	0
chr3:142365047\|142384685	UPF1	0	1	0
chr3:142365047\|142384685	TAF15	2	0	0
chr3:142365047\|142384685	FMR1	0	0	1
chr3:142365047\|142384685	TROVE2	0	0	1
chr3:142365047\|142384685	FUS	1	0	0
chr3:142365047\|142384685	NOP58	1	1	1
chr3:142365047\|142384685	U2AF2	3	4	0
chr3:142365047\|142384685	DDX54	0	0	4
chr3:142365047\|142384685	HNRNPM	0	1	0
chr3:142365047\|142384685	FIP1L1	0	1	0
chr3:142365047\|142384685	PTBP1	0	9	0
chr3:142365047\|142384685	HNRNPC	6	8	3
chr3:142365047\|142384685	HNRNPD	2	0	0
chr3:142365047\|142384685	ACIN1	0	0	1
chr3:142365047\|142384685	SMNDC1	0	0	1
chr3:142365047\|142384685	HNRNPA1	1	3	0
chr3:142365047\|142384685	LIN28B	0	0	1
chr3:142365047\|142384685	IGF2BP2	1	1	2
chr3:142365047\|142384685	TARDBP	0	1	0
chr3:142365047\|142384685	BUD13	0	0	1
chr3:142365047\|142384685	SUGP2	0	1	0
chr3:142365047\|142384685	CSTF2T	0	1	1
chr3:142365047\|142384685	CSTF2	0	1	0
chr3:142365047\|142384685	EIF4A3	0	3	3
chr3:142365047\|142384685	FBL	0	0	3

CircRNA Information