CircRNA Information

General Information
circRNA Basic Information
CircID chr3:182820260|182898772
Strand +
CircType exon
Host Gene ENSG00000058063.15;
Algorism find_circ;CIRI2;DCC;
Sequence TACACTGTGTGGAATTTTGTTCCAAAAAATTTATTTGAACAGTTCAGAAGAGTGGCAAACTTTTATTTTCTTATTATATTTTTGGTTCAG
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr3:182820260|182898772 FBL 2 0 0
chr3:182820260|182898772 BUD13 1 0 0
chr3:182820260|182898772 ELAVL1 1 0 3
chr3:182820260|182898772 NOP56 0 1 0
chr3:182820260|182898772 RBFOX2 0 1 0
chr3:182820260|182898772 U2AF2 3 1 1
chr3:182820260|182898772 RANGAP1 1 0 0
chr3:182820260|182898772 DDX54 0 0 2
chr3:182820260|182898772 TIA1 0 1 0
chr3:182820260|182898772 FXR2 1 0 0
chr3:182820260|182898772 UPF1 2 0 0
chr3:182820260|182898772 TIAL1 0 1 0
chr3:182820260|182898772 TAF15 0 1 0
chr3:182820260|182898772 HNRNPL 0 1 0
chr3:182820260|182898772 FMR1 1 0 0
chr3:182820260|182898772 RBM22 0 2 0
chr3:182820260|182898772 IGF2BP3 0 1 0
chr3:182820260|182898772 IGF2BP2 2 2 0
chr3:182820260|182898772 EIF4A3 3 0 1
chr3:182820260|182898772 FUS 2 0 0