CircNet

General Information

circRNA Basic Information

CircID	chr3:52911003\|52916214
Strand	-
CircType	exon
Host Gene	ENSG00000163935.13;
Algorism	find_circ;CIRI2;CIRC
Sequence	CCTACAAACCCAGCCGTGTCCTTCGGGAGCTCCAGCTGGACAAAGACTCTGTGTGGCACGGATGTGGGGAAGTCCTAAAAGCCAA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr3:52911003\|52916214	SLBP	0	0	1
chr3:52911003\|52916214	ELAVL1	0	0	1
chr3:52911003\|52916214	HNRNPA1	2	0	0
chr3:52911003\|52916214	U2AF2	11	5	0
chr3:52911003\|52916214	CSTF2T	0	1	0
chr3:52911003\|52916214	DDX54	0	0	2
chr3:52911003\|52916214	CSTF2	0	1	0
chr3:52911003\|52916214	FUS	0	1	0
chr3:52911003\|52916214	FXR2	0	0	1
chr3:52911003\|52916214	RBM10	1	0	0
chr3:52911003\|52916214	UPF1	1	0	0
chr3:52911003\|52916214	TROVE2	1	0	0
chr3:52911003\|52916214	TARDBP	0	1	0
chr3:52911003\|52916214	FMR1	0	0	2
chr3:52911003\|52916214	NOP58	1	1	0
chr3:52911003\|52916214	NUDT21	0	1	0
chr3:52911003\|52916214	HNRNPC	2	1	0
chr3:52911003\|52916214	PTBP1	0	1	0
chr3:52911003\|52916214	EIF4A3	4	1	2
chr3:52911003\|52916214	AGO2	1	0	2

CircRNA Information