CircNet

General Information

circRNA Basic Information

CircID	chr4:119217550\|119273708
Strand	+
CircType	exon
Host Gene	ENSG00000145390.11;
Algorism	find_circ;CIRI2;DCC;
Sequence	ATGCTTGGGATTTGCTTTACATTCTAAGTGGATTTGGAGAAGAGACAATAAAGAATAAGCAGTCAATTCTATAATATATTTAGAAGGAGAAAAGTGCCAAGGAGGAATGAAAAAGTAGAACAAGTGACCAGATTACGACAAGCAACCTAAATAAAGAACGTGGGGACTGTACCTCCCTTCAGAGCCAACATCACTTAGAAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan
chr4:119217550\|119273708	hsa-miR-212-5p	0	1	1

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr4:119217550\|119273708	NOP56	1	1	0
chr4:119217550\|119273708	FUS	3	0	0
chr4:119217550\|119273708	SF3B4	1	0	0
chr4:119217550\|119273708	CNBP	1	0	0
chr4:119217550\|119273708	UPF1	0	1	0
chr4:119217550\|119273708	TAF15	1	0	0
chr4:119217550\|119273708	SRSF7	0	0	1
chr4:119217550\|119273708	SRSF1	2	0	0
chr4:119217550\|119273708	NOP58	1	2	2
chr4:119217550\|119273708	U2AF1	1	0	1
chr4:119217550\|119273708	U2AF2	4	1	0
chr4:119217550\|119273708	SRSF9	1	0	1
chr4:119217550\|119273708	DDX54	0	0	4
chr4:119217550\|119273708	HNRNPD	0	1	0
chr4:119217550\|119273708	ACIN1	0	0	1
chr4:119217550\|119273708	IGF2BP1	0	0	1
chr4:119217550\|119273708	IGF2BP2	0	0	2
chr4:119217550\|119273708	TARDBP	0	1	0
chr4:119217550\|119273708	BUD13	0	1	2
chr4:119217550\|119273708	KHSRP	1	2	0
chr4:119217550\|119273708	RBM47	0	0	1
chr4:119217550\|119273708	CSTF2T	0	0	1
chr4:119217550\|119273708	FBL	0	0	1
chr4:119217550\|119273708	EIF4A3	0	1	2
chr4:119217550\|119273708	AGO2	1	0	0

CircRNA Information